Spatial frequency maps for hg G sub-clades that attained 10% frequency in at least one population were obtained by applying the haplogroup frequencies from Supplementary Table S1. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. But unusual values or unusual value combinations found at short tandem repeat markers (STRs) can also provide the basis of additional taxonomisation. Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF : New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree. The fragments were run on the ABI PRISM 3130xl Genetic Analyzer (Applied Biosystems). (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. In the Near/Middle East, the highest P303 frequency is detected among Palestinians (17.8%), whereas in Europe the frequency does not exceed 6%. Haplogroup K2a (M2308) and its primary subclade K-M2313 were separated from Haplogroup NO (F549) in 2016. In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. Members of this group have been found in Europe and the Middle East.[3]. Semino et al. G-PF3147 (previously G-L223 and G-PF3146) is characterized by having the L223 mutation. Proc Natl Acad Sci USA 2011; 108: 1825518259. It is a child of haplogroup M12'G. It was likely born in the East Asia around 32,000 years ago. Dulik MC, Zhadanov SI, Osipova LP et al. For the multi-copy STR DYS389I,II the DYS389b value was DYS389I subtracted from DYS389II. The most commonly occurring subclades are G1* (M285) and many subclades of G2 (G-P287), especially: G2a (P15), G2a1 (G-FGC7535, formerly G-L293), G2a2b2a (G-P303) formerly G2a3b1); G2a2b1 (G-M406) formerly G2a3a; G2a2b2a1 (G-L140) formerly G2a3b1a; G2a2b2a1a1b (G-L497) formerly G2a3b1a2; G2a2b2a1a1a1 (G-L13) formerly G2a3b1a1a; G2a2b2a1a1c1a (G-CTS5990 or G-Z1903) formerly G2a3b1a3; G2b (G-M3115) and; G2b1 (G-M377), formerly G2b. It has been found in Mexican mestizos. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. G-L91 would seem to encompass a significant proportion of men belonging to G. L91 is found so far in scattered parts of Europe and North Africa and in Armenia. The frequency data were converted into isofrequency maps using the Surfer software (version 8, Golden Software, Inc., Golden, CO, USA), following the kriging algorithm using advanced options to use bodies of waters as breaklines. Goncalves R, Freitas A, Branco M et al. This value of 12 is uncommon in other G categories other than G1. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. Hum Genet 2009; 126: 707717. However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. [23] About 6% of the samples from Sri Lanka and Malaysia were reported as haplogroup G, but none were found in the other coastal lands of the Indian Ocean or Pacific Ocean in Asia. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. (2000) suggested 17,000 years ago. [44] The "U" SNPs were identified in 2006 but not published until 2009.[45]. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. This group has been linked with the Crypto-Jewish population which fled to the island during the time of the Spanish Inquisition, of which a significant portion are identifiable as G-Z725 (DYS388=13). Almost all L141 men belong to L141 subclades. Its chromosome location listed as 21653414. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. The presence of hg G was first reported in Europe and Georgia5 and later described in additional populations of the Caucasus.6 Subsequently, several data sets containing hg G-related lineages have been presented in studies of different European populations7, 8, 9, 10 and so on, as well as studies involving several Middle Eastern and South Asian populations.4, 11, 12, 13, Hg G, together with J2 clades, has been associated with the spread of agriculture,5 especially in the European context. To accommodate for variability in sample sizes and hg G content, haplogroup diversity was calculated using the method of Nei37 only in the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Its identification caused considerable renaming of G categories. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". Semino et al. These patterns have been related to different migratory events and demographic processes.2, 10, 11, 14, 15, 16. Capelli C, Brisighelli F, Scarnicci F et al. There are multiple SNPs which so far have the same coverage as P15. Hammer MF, Behar DM, Karafet TM et al. The following SNPs are so far identified as M201 equivalents: L116, L154, L269, L294, L240, P257, L402, L520, L521, L522, L523, L605, Page 94, U2, U3, U6, U7, U12, U17, U20, U21, U23 and U33. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. In other words, these mutations are so unique that they could only come from other cells with the same mutations. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. International Society of Genetic Genealogy (ISOGG; 2015), "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences", https://en.wikipedia.org/w/index.php?title=Haplogroup_G-M201&oldid=1139571590, Articles with dead external links from January 2020, Articles with permanently dead external links, All articles with bare URLs for citations, Articles with bare URLs for citations from April 2022, Articles with spreadsheet file bare URLs for citations, Short description is different from Wikidata, Articles with self-published sources from October 2020, Articles with unsourced statements from November 2017, Articles with unsourced statements from September 2022, Articles with unsourced statements from July 2017, Wikipedia articles in need of updating from February 2021, All Wikipedia articles in need of updating, Creative Commons Attribution-ShareAlike License 3.0, M201, PF2957, L116, L154, L204, L240, L269, L402, L520, L521, L522, L523, L605, L769, L770, L836, L837, M201, P257/U6, Page94/U17, U2, U3, U7, U12, U20, U21, U23, U33, Other males purported to be members of Haplogroup G include: German-American pioneer and soldier, This page was last edited on 15 February 2023, at 20:17. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa. The phylogeny obtained for haplogroup Q-M378 comprising 5.2% of the Ashkenazi paternal variation 24, shows a similar pattern to that observed for haplogroup G-M377 (Supplemental Figure S5). These two reported Pakistani G-M377 haplotypes are quite divergent from the Ashkenazi Jewish clade, and therefore do not at all indicate a recent common origin. Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. G1-M285, previously described in the Iranian population . The corresponding coalescent estimate for M377 is 5600 years ago (Supplementary Table S4). Forensic Sci Int-Gen 2007; 1: 287290. Parent Branch: G-FGC5081 Descendant branch(s): G-Z17084 G-Z45043 FTDNA Tree Link: Link YFull Info. Samples from persons with British Isles, Sicilian and Turkish ancestry have been identified. ), Haplogroup M, as of 2017, is also known as K2b1b. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. See: Poznik. Cinnioglu C, King R, Kivisild T et al. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Mitochondrial DNA and Y Chromosome Variation Provides Evidence for a Recent Common Ancestry between Native Americans and Indigenous Altaians. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). Origin. Mitochondrial DNA variation of modern Tuscans supports the near eastern origin of Etruscans. Amongst the Madjars, G1 was found at a rate of 87%. Its age is between 7,700 and . In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations. Bosch E, Calafell F, Comas D, Oefner PJ, Underhill PA, Bertranpetit J : High-resolution analysis of human Y-chromosome variation shows a sharp discontinuity and limited gene flow between northwestern Africa and the Iberian Peninsula. OS thanks the Italian Ministry of the University: Progetti Ricerca Interesse Nazionale 2009 and FIRB-Futuro in Ricerca 2008 and Fondazione Alma Mater Ticinensins. Battaglia V, Fornarino S, Al-Zahery N et al. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). Hg G is very frequent in NW Caucasus and South Caucasus, covering about 45% of the paternal lineages in both regions2 in this study. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Thus inferences regarding migratory histories must be viewed cautiously, as diversities may have changed over the time spans discussed. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. Zhivotovsky LA, Underhill PA, Cinnioglu C et al. The M201 SNP mutation that characterizes haplogroup G was identified at Stanford University and was first reported in 2001. . Semino O, Magri C, Benuzzi G et al. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. Slider with three articles shown per slide. Am J Hum Genet 2003; 72: 313332. While it is found in percentages higher than 10% among the Bakhtiari, Talysh people, Gilaki, Mazandarani and Iranian Azeris, it is closer to 5% among the Iranian Arabs and in some large cities. . The G-L13 subclade is most common in north central Europe, and G-Z1266 is most common in the western Caucasus Mountains. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. The L91 mutation is found at 21327383 and rs35474563 on the Y-chromosome. The reliability of both P16 and P18 in identifying everyone in each of these categories has been questioned and individual components of the SNP have to be examined. The L141 mutation involves an insertion.[35]. Science 2000; 290: 11551159. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. New York: Columbia University Press, 1987. Eur J Hum Genet 2004; 12: 855863. Am J Hum Genet 2002; 70: 265268. This is achieved by comparing the haplotypes through the STR markers. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In Lebanon, however, G accounts for 6.5% of the population and in Iran to around 10%. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. Haplogroup G was the first branch of Haplogroup F outside of Africa. We estimate that the geographic origin of hg G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. Haplogroup G (M201) is a human Y-chromosome haplogroup. Among Jews in Israel drawn from many areas of the world, G-M377 constituted 3.7% in one study. The Sea Peoples, from cuneiform tablets to carbon dating. Mol Phylogenet Evol 2007; 44: 228239. Google Scholar. In the Tirol (Tyrol) of western Austria, the percentage of G-M201 can reach 40% or more; perhaps the most famous example is the ancient remains of the so-called "Iceman", tzi. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. The 96 populations were collapsed into 50 regionally defined populations by excluding populations where the total G count was less than n=5. Y-chromosomal diversity in Lebanon is structured by recent historical events. Distribution. https://doi.org/10.1038/ejhg.2012.86, DOI: https://doi.org/10.1038/ejhg.2012.86. ISSN 1476-5438 (online) Polarity and temporality of high-resolution y-chromosome distributions in India identify both indigenous and exogenous expansions and reveal minor genetic influence of Central Asian pastoralists. The final major subclade is characterized by presence of the SNP Z1903 and by a value of 9 at marker DYS568. The SNP L177 (a.k.a. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. Hum Genet 2004; 114: 127148. G2a2b1 is more common in southern Europe than northern Europe. Kayser M, Caglia A, Corach D et al. Nat Commun 2012; 3. de Knijff P, Kayser M, Caglia A et al. A network analysis of representative hg G-P16 Y-STR haplotypes reveals a diffuse cluster (Supplementary Figure S2). Samples have been identified in England, Germany, Montenegro (Bosniak), Spain, Cyprus (Greek), Turkey, Armenia, Georgia, Lebanon, Syria and Kuwait. The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. Principal component analysis based on G sub-haplogroup frequencies was performed using the freeware POPSTR program (http://harpending.humanevo.utah.edu/popstr/). First, we calculated haplogroup diversity using data in Supplementary Table S1 for the 52 instances when total population sample size exceeded 50 individuals and 5hg G chromosomes were observed. Mitochondrial haplogroup N is a "Macro-haplogroup", also called a "Superhaplogroup." All humans who left Africa descended from mtDNA haplogroup L3, and that ancient lineage soon gave rise to two great daughter families, M and N, which, in turn, became the mothers of billions. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. Flores C, Maca-Meyer N, Gonzalez AM et al. K-M2313*, which as yet has no phylogenetic name, has been documented in two living individuals, who have ethnic ties to India and South East Asia. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. Semino O, Magri C, Benuzzi G, Lin AA, Al-Zahery N, et al. G-P16 has a high frequency in South and NW Caucasus, with the highest frequency among North Ossetians63.6%. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Correspondence to Finally, to the east, G2a3a-M406 has an expansion time of 8800 years ago in Iran, a time horizon that corresponds to the first Neolithic settlements of the Zagros Mountains of Iran. Proc Natl Acad Sci USA 2011; 108: 97889791. Gurdeep Matharu Lall, Maarten H. D. Larmuseau, Mark A. Jobling, Hovhannes Sahakyan, Ashot Margaryan, Richard Villems, Javier Rodriguez Luis, Leire Palencia-Madrid, Rene J. Herrera, Sandra Oliveira, Alexander Hbner, Jorge Rocha, Alessandra Modi, Desislava Nesheva, David Caramelli, Maxat Zhabagin, Zhaxylyk Sabitov, Elena Balanovska, Veronika Csky, Dniel Gerber, Anna Szcsnyi-Nagy, European Journal of Human Genetics The Genetic Legacy of Paleolithic Homo sapiens sapiens in Extant Europeans: A Y Chromosome Perspective. Int J Legal Med 1997; 110: 134149. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Summary. There are additional subclades of DYS388=13 men characterized by the presence of specific SNPs or uncommon STR marker oddities. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Evolutionary Biology Group, Estonian Biocentre, Tartu, Estonia, Siiri Rootsi,Mari Jrve,Ildus Kutuev,Krt Varendi,Hovhannes Sahakyan,Doron M Behar,Alena Kushniarevich&Richard Villems, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA, USA, Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Institute of Biochemistry and Genetics, Ufa Research Center, Russian Academy of Sciences, Ufa, Russia, Ildus Kutuev,Elza K Khusnutdinova&Rita Khusainova, Departamento de Gentica, Facultad de Biologa, Universidad de La Laguna, Tenerife, Spain, Human Genetics Group, Institute of Molecular Biology, Academy of Sciences of Armenia, Yerevan, Armenia, Hovhannes Sahakyan,Levon Yepiskoposyan&Ardeshir Bahmanimehr, Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia, Institute for Anthropological Research, Zagreb, Croatia, Immunology department, Allergy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, Department of Human and Molecular Genetics, College of Medicine, Florida International University, Miami, FL, USA, Dipartimento di Biologia e Biotecnologie L. Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. Int J Legal Med 1997; 110: 141149. Various estimated dates and locations have been proposed for the origin of G-M201, most of them in Western Asia. This is not surprising, as clines are not expected in cases of sharp changes in haplogroup frequency over a relatively small distance such as those observed for hg G, for instance between the Caucasus and Eastern Europe. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). Haplogroup L2b1a is a branch on the maternal tree of human kind. Haplogroup G represents one of the first peoples in Europe. Y chromosomal heritage of Croatian population and its island isolates. Haplogroup F is the parent of haplogroups from G to R; however excluding these common haplogroups, the minor clades F*, F1, and F2, seem to appear in the Indian continent [68]. The Iceman belongs to haplogroup G2a2b [13] (earlier called G2a4). Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Furthermore, markers Page94, U5, U8 and L30 were typed in contextually appropriate samples to establish the position of the five new markers within the phylogeny. You belong to a subgroup of haplogroup G (G-M201), The Caucasus Mountaineers, and your oldest. Pichler I, Fuchsberger C, Platzer C et al. Am J Hum Genet 2012; 90: 573. Ann Hum Genet 2008; 72: 205214. PubMedGoogle Scholar. But a high percentage of U1 men belong to its two subclades, G-L13/S13 and Z1266 (G2a3b1a1b). Princeton: Princeton University Press, 1994. The presence of M527 in Provence, southern Italy and Ukraine may reflect subsequent Greek maritime Iron Age colonization events16 and perhaps, given its appearance among the Druze and Palestinians, even episodes associated with the enigmatic marauding Sea Peoples.42. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). In addition, there are multiple other SNPs thought to have the same coverage as M201. The P303 SNP defines the most frequent and widespread G sub-haplogroup. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Kivisild T, Rootsi S, Metspalu M et al. Herein . The National Geographic Society places haplogroup G origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. The Etruscans: a population-genetic study. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. M286 was first identified at Stanford University at chromosome position 21151187, and is a mutation from G to A. [4], Two scholarly papers have also suggested an origin in the Middle East, while differing on the date. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. Extended Y chromosome haplotypes resolve multiple and unique lineages of the Jewish priesthood. Farther north, 8% of ethnic Hungarian males and 5.1% of ethnic Bohemian (Czech) males have been found to belong to Haplogroup G. In South Asia, some ethnic minorities possess haplogroup G at concentrations of approximately 18%[21] to 20%[22] of Kalash, approximately 16% of Brahui,[22] and approximately 11.5% of sampled Pashtun,[21] but in only about 3% of the general Pakistani population. The highest frequencies of haplogroup G appear in the Caucasus region; however it also shows significant frequencies in the Mediterranean areas and the Middle East [69,70]. Am J Hum Genet 2004; 74: 10231034. The authors declare no conflict of interest. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. Behar DM, Yunusbayev B, Metspalu M et al. Men with the haplogroup G marker moved into Europe in Neolithic times. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. 25 and 0.00069 denote the assumed average generation time in years and the effective mutation rate, respectively, and 1000 is used to convert the result of the equation (into thousands of years). L2b1a. Although hg G1 frequency distribution, overall, extends further eastward as far as Central Asian Kazakhs (present even among Altaian Kazakhs38 with identical STR haplotypes compared with the main Kazakh population), it is virtually absent in Europe. Origin. (Previously the name Haplogroup M was assigned to K2b1d. Peter A Underhill. Men who belong to this group but are negative for all its subclades represent a small number today. Article G-M377, now also known as G2b1, has previously been designated G2b and G2c. A clade of closely related Ashkenazi Jews represent virtually all G2b persons, with just three other G2b haplotypes having been reported so far: one Turk from Kars in northeast Turkey near Armenia, one Pashtun, and one Burusho in Pakistan. It is notable that tzi the 5300-year-old Alpine mummy was derived for the L91 SNP and his autosomal affinity was nearest to modern Sardinians.28, The G2a2-M286 lineage is very rare, so far detected only in some individuals in Anatolia and the South Caucasus. [5] Cinnioglu et al. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. Another frequent sub-clade of the G2a3-M485 lineage is G2a3a-M406 (Figure 2e). Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. The Y-chromosomal haplogroup G (hg G) is currently defined as one of the 20 standard haplogroups comprising the global Y-chromosome phylogeny.1 The phylogeographic demarcation zone of hg G is largely restricted to populations of the Caucasus and the Near/Middle East and southern Europe. Balanovsky O, Rootsi S, Pshenichnov A et al. Am J Hum Genet 2008; 82: 873882. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also widely distributed at low frequencies among ethnic groups throughout Europe, South Asia, Central Asia, and North Africa . [43] L240 was identified in 2009. This haplogroup was found in a Neolithic skeleton from around 5000 BC, in the cemetery of Derenburg Meerenstieg II, Germany, which forms part of the Linear Pottery culture, known in German as Linearbandkeramik (LBK),[11] but was not tested for G2a3 subclades.
Maria Belon Injuries Pictures,
Vickie Chapman Hindmarsh Island,
Second Hand Wedding Dresses Christchurch,
What Is Martha Raddatz Net Worth,
Laptop Using Integrated Graphics Instead Of Gpu Amd,
Articles H